Internal ID | 2576977 | Source Database | A cross-reference and link to the record at is not available yet. |
Feature Type | Inverted repeat |
Name |
Palindrome
|
Sequence |
CGGCGTGTTTCACGTGAAACACGCCG Look for more occurrences |
Start | 3271061 |
End | 3271086 |
Strand | + |
Genomic Context | |
Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | Software: Palindrome (EMBOSS 6.4.0.0) |
EMBOSS: the European Molecular Biology Open Software Suite.
Rice P, Longden I, Bleasby A.
Trends Genet. 2000 Jun;16(6):276-7.
PubMed ID: 10827456
|