| Internal ID | 1787589 | Source Database | TransTermHP TERM 224 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 224
|
| Sequence |
GCCCCGGCCGCTCGCGCGCCGGGGC Look for more occurrences |
| Start | 1035267 |
| End | 1035291 |
| Strand | + |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia H111 chromosome 2, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GTGGTTGTTCCGTTG(5' tail) GCCCCGGCCGC(5' stem) TCGC(loop) GCG-CCGGGGC(3' stem) TTTTTTGTTTGCGCG(3' tail). Confidence: 100. gap 1 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|