| Internal ID | 1787517 | Source Database | TransTermHP TERM 95 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 95
|
| Sequence |
GGCGCCGCCGACGGCCGGCGGCGCC Look for more occurrences |
| Start | 546999 |
| End | 547023 |
| Strand | - |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia H111 chromosome 2, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGTCGTTCCGGACAA(5' tail) GGCGCCGCCG(5' stem) GCCGT(loop) CGGCGGCGCC(3' stem) CGTCGCATTACACCG(3' tail). Confidence: 100. opp_overlap 547017 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|