Internal ID | 1787497 | Source Database | TransTermHP TERM 64 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 64
|
Sequence |
CGGCGGCCGCACCGAGGCGGCCGCCG Look for more occurrences |
Start | 411663 |
End | 411688 |
Strand | + |
Genomic Context | |
Replicon | Burkholderia cenocepacia H111 chromosome 2, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGCTGAAGCAGCATG(5' tail) CGGCGGCCGC(5' stem) ACCGAG(loop) GCGGCCGCCG(3' stem) GTTTCCATTCACTGA(3' tail). Confidence: 93. opp_overlap 411658, overlap 411662 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|