| Internal ID | 1787448 | Source Database | TransTermHP TERM 1267 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1267
|
| Sequence |
CCCCAAGAATCGGAAGGTTCTTGGGG Look for more occurrences |
| Start | 3439838 |
| End | 3439863 |
| Strand | - |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia H111 chromosome 1 complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCACAAACGAAAAA(5' tail) CCCCAAGAACC(5' stem) TTCC(loop) GATTCTTGGGG(3' stem) TTTTAAATGCTGGTG(3' tail). Confidence: 100. opp_overlap 3439838 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|