| Internal ID | 1787279 | Source Database | TransTermHP TERM 1017 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1017
|
| Sequence |
CCCGGCGCAAATGCGCCGGG Look for more occurrences |
| Start | 2798130 |
| End | 2798149 |
| Strand | - |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia H111 chromosome 1 complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TATCTGACGAAGAAA(5' tail) CCCGGCGC(5' stem) ATTT(loop) GCGCCGGG(3' stem) TTTCTTTTTTTGTGG(3' tail). Confidence: 100. opp_overlap 2798126, overlap 2798107 2798126 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|