Internal ID | 1787178 | Source Database | TransTermHP TERM 885 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 885
|
Sequence |
CAAGCCCCGTATTGACGGGGCTTTG Look for more occurrences |
Start | 2431820 |
End | 2431844 |
Strand | - |
Genomic Context | |
Replicon | Burkholderia cenocepacia H111 chromosome 1 complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGACGCACAAAAAAA(5' tail) CAAAGCCCCGT(5' stem) CAAT(loop) ACGGGGC-TTG(3' stem) CTTATCGCTCGGCGC(3' tail). Confidence: 100. gap 1, opp_overlap 2431824, overlap 2431824 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|