Internal ID | 1764918 | Source Database | TransTermHP TERM 326 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 326
|
Sequence |
CGGGCCGCTCGAAAGAGCGGCCCG Look for more occurrences |
Start | 1632171 |
End | 1632194 |
Strand | - |
Genomic Context | |
Replicon | Burkholderia cenocepacia AU 1054 chromosome 2, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGCGCACAACGACAA(5' tail) CGGGCCGCTC(5' stem) TTTC(loop) GAGCGGCCCG(3' stem) TTTTCATTGATGCCC(3' tail). Confidence: 100. opp_overlap 1632171, overlap 1632166 1632165 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|