Internal ID | 1761234 | Source Database | TransTermHP TERM 977 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 977
|
Sequence |
GCCGCGTGTCCGTCGAGGAGCGCGGC Look for more occurrences |
Start | 3101836 |
End | 3101861 |
Strand | - |
Genomic Context | |
Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGAAAAACAAAAAA(5' tail) GCCGCGC-TCC(5' stem) TCGAC(loop) GGACACGCGGC(3' stem) TCTTTTGAAGAGCGG(3' tail). Confidence: 100. gap 1, opp_overlap 3101836 3101834, overlap 3101829 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|