Internal ID | 1761058 | Source Database | TransTermHP TERM 744 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 744
|
Sequence |
CGGCCCGCGCATCGCTGCGCGGGCCG Look for more occurrences |
Start | 2460225 |
End | 2460250 |
Strand | + |
Genomic Context | |
Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGACACCAATGAAAA(5' tail) CGGCCCGCGCA(5' stem) TCGC(loop) TGCGCGGGCCG(3' stem) TCGTTCCATTTACAG(3' tail). Confidence: 100. opp_overlap 2460225, overlap 2460222 2460219 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|