| Internal ID | 1761048 | Source Database | TransTermHP TERM 726 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 726
|
| Sequence |
CCGGCCGCGTGATGCGGCGCGGCCGG Look for more occurrences |
| Start | 2418576 |
| End | 2418601 |
| Strand | - |
| Genomic Context | Located within gene [BCEN_RS10920] |
| Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCTTCGCGACGAAA(5' tail) CCGGCCGCGC(5' stem) CGCATC(loop) ACGCGGCCGG(3' stem) GCCTCCCATCGCGGT(3' tail). Confidence: 90. opp_overlap 2418590 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|