| Internal ID | 1751104 | Source Database | TransTermHP TERM 463 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 463
|
| Sequence |
GCCCCGGCCGCTCGCGCGCCGGGGC Look for more occurrences |
| Start | 2414808 |
| End | 2414832 |
| Strand | - |
| Genomic Context | |
| Replicon | Burkholderia sp. 383, complete sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCAAACGCAAAAAA(5' tail) GCCCCGG-CGC(5' stem) GCGA(loop) GCGGCCGGGGC(3' stem) CAACGGAACAACCAC(3' tail). Confidence: 100. gap 1 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|