Internal ID | 1586736 | Source Database | TransTermHP TERM 5 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 5
|
Sequence |
GGGCGGGAATCCGACGATTCCCGCCC Look for more occurrences |
Start | 12887 |
End | 12912 |
Strand | + |
Genomic Context | |
Replicon | Burkholderia cenocepacia K56-2Valvano ctg7180000002942, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGCACAAAGAAAAA(5' tail) GGGCGGGAATC(5' stem) CGAC(loop) GATTCCCGCCC(3' stem) TTTTGTATTTCGGCG(3' tail). Confidence: 100. opp_overlap 12887, overlap 12882 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|