| Internal ID | 1586735 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
GGGCGGGAATCGTCGGATTCCCGCCC Look for more occurrences |
| Start | 12887 |
| End | 12912 |
| Strand | - |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia K56-2Valvano ctg7180000002942, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCGCACAAAGAAAAA(5' tail) GGGCGGGAATC(5' stem) CGAC(loop) GATTCCCGCCC(3' stem) TTTTGTATTTCGGCG(3' tail). Confidence: 100. opp_overlap 12887 12882 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|