Internal ID | 1586341 | Source Database | TransTermHP TERM 19 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 19
|
Sequence |
GGCGCCGCCGACGGCCGGCGGCGCC Look for more occurrences |
Start | 69086 |
End | 69110 |
Strand | - |
Genomic Context | |
Replicon | Burkholderia cenocepacia K56-2Valvano ctg7180000002940B, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGTCGTTCCGGACAA(5' tail) GGCGCCGCCG(5' stem) GCCGT(loop) CGGCGGCGCC(3' stem) CGTCGCATTACACCG(3' tail). Confidence: 100. opp_overlap 69104 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|