Internal ID | 1585824 | Source Database | TransTermHP TERM 100 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 100
|
Sequence |
CGGTCGGCAGCCGCCGGCCG Look for more occurrences |
Start | 302017 |
End | 302036 |
Strand | + |
Genomic Context | |
Replicon | Burkholderia cenocepacia K56-2Valvano ctg7180000002940C, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ATAGACTGGGTCTCA(5' tail) CGGTCGGC(5' stem) AGCC(loop) GCCGGCCG(3' stem) TTTTCTTCGGAGATC(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|