| Internal ID | 1761212 | Source Database | TransTermHP TERM 951 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 951
|
| Sequence |
CGCCACGTGTCCCACGTGGCA Look for more occurrences |
| Start | 3040701 |
| End | 3040721 |
| Strand | - |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACACCTTAAAACAAA(5' tail) TGCCACGTG(5' stem) GGA(loop) CACGTGGCG(3' stem) ATTTTTGGCAGGGGC(3' tail). Confidence: 93. opp_overlap 3040700 3040701 3040702, overlap 3040702 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|