| Internal ID | 1761120 | Source Database | TransTermHP TERM 835 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 835
|
| Sequence |
GCGCGCGGCCTGCCGCGCGC Look for more occurrences |
| Start | 2721381 |
| End | 2721400 |
| Strand | + |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCTGCTTCCCGAAA(5' tail) GCGCGCGG(5' stem) CCTG(loop) CCGCGCGC(3' stem) TTTTTGTTTTTCCGG(3' tail). Confidence: 100. opp_overlap 2721364 2721381, overlap 2721375 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|