Internal ID | 1761080 | Source Database | TransTermHP TERM 777 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 777
|
Sequence |
CGGCGATGCTCGTGCGAGCGTCGCCG Look for more occurrences |
Start | 2566488 |
End | 2566513 |
Strand | + |
Genomic Context | |
Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GAGGACCATAAAAAA(5' tail) CGGCGATGCTC(5' stem) GTGC(loop) GAGCGTCGCCG(3' stem) TTTTCACATCCACTC(3' tail). Confidence: 95. opp_overlap 2566488 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|