| Internal ID | 1586198 | Source Database | TransTermHP TERM 8 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 8
|
| Sequence |
GCGGCGGCCTGCGGGCCGCCGC Look for more occurrences |
| Start | 15193 |
| End | 15214 |
| Strand | - |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia K56-2Valvano ctg7180000002937, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TAGCTTGAATCAAAA(5' tail) GCGGCGGCC(5' stem) CGCA(loop) GGCCGCCGC(3' stem) CGGGTTCAGTGCAGC(3' tail). Confidence: 100. opp_overlap 15200 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|