Internal ID | 1586196 | Source Database | TransTermHP TERM 6 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 6
|
Sequence |
GCGACACGTCGTTGGACGTGTCGC Look for more occurrences |
Start | 14653 |
End | 14676 |
Strand | + |
Genomic Context | |
Replicon | Burkholderia cenocepacia K56-2Valvano ctg7180000002937, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGCTCGAACAAAAAA(5' tail) GCGACACGTC(5' stem) GTTG(loop) GACGTGTCGC(3' stem) TTTTTTTTCCTTGTG(3' tail). Confidence: 100. opp_overlap 14653 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|